Resultados de la búsqueda

1. Population genetic structure of Patagonian toothfish in the West Indian Ocean sector of the Southern Ocean

   fishing locations. File:  02appleyard-etal.pdf ... appleyard et al proof.indd CCAMLR Science, Vol. 11 ... the area of application of CCAMLR. Little is known about the stock structure or degree of stock ... , CCAMLR 23 Population genetic structure of Patagonian toothfi sh case, the genetic differentiation ... of the Southern Ocean. A number of countries fi sh in both CCAMLR and national fi shing grounds ...

   Science Journal Paper : CCAMLR Science, Volume 11 (CCAMLR Science, Volume 11) : 21–32 : Autor(es): Appleyard, S.A., R. Williams and R.D. Ward

2. Homogeneity of Adélie penguins as krill samplers

   factors pertaining to the predator. File:  15-Marschoff-and-Gonzalez.pdf ... BapHal1,HH (-0,26) He~ OTJIW-IaJIC5I 3Ha4HTeJIbHO OT HyJI5I (F=0,093; 3 = 0,54). 3TOT pe3YJIbTaT nO,ll ... values of c until a significant result was obtained. 254 3. RESULTS A total of 11 marked Ad6lie ... (SC-CAMLR-SSP/6). CCAMLR, Hobart, Australia: 367-376. MARSCHOFF, E. and B.N. GONZALEZ. 1990 ... in the diet of penguins. In: Selected Scientific Papers, 1990 (SC-CAMLR-SSPI7). CCAMLR, Hobart ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/9 (Selected Scientific Papers, SC-CAMLR-SSP/9) : 253–257 : Autor(es): Marschoff, E. and B. Gonzalez

3. Evaluation of the results of trawl selectivity experiments by Poland, Spain and USSR in 1978/79, 1981/82 and 1986/87

   commercial fishery in Statistical Area 48. File:  13-Slosarczyk-et-al.pdf ... codends on Antarctic fish were evaluated in the light of additional information presented to the CCAMLR ... Committee of CCAMLR (8alguerias, 1988; Efanov et al., 1989; Zaucha, 1986 and 1988). 2. COMMENTS ON ... properly evaluated on the basis of available data. Polish hauls of 2 to 3 hours resulted in some cases in ... (Figure 3; see also Table 1.1 of the Appendix). Similarly, no clear relationship was observed between SF ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/6 (Selected Scientific Papers, SC-CAMLR-SSP/6) : 163–196 : Autor(es): Slosarczyk, W., E. Balguerias, K. Shust and S. Iglesias

4. Analysis of krill trawling positions north of the South Shetland Islands (Antarctic Peninsula area), 1980/81–1999/2000

   effect. File:  02kawaguchi-segawa.pdf ... ecosystem. CCAMLR Science, 3: 13-30. Ichii, T. 2000. Krill harvesting. In: Everson, I. (Ed.). Krill ... CCAMLR Scie~~ce, Vol. 8 (2001): 25-36 ANALYSIS OF ... , TO MecTa TpaneHm B OCHOBHOM 3 a ~ ~ c e n ~ OT pacnpegeneHMx 6onee KpynHoro, nonoeospenoro KpHJIR ... sene~oro K ~ M I I X ) , Tatime o ~ a 3 b r ~ a n ~ ~ o s p a c ~ a l o ~ e e BnMxHHe Ha MecTa ...

   Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 25–36 : Autor(es): Kawaguchi, S. and K. Segawa

5. Age determination of Champsocephalus gunnari Lönnberg, 1905 (Channichthyidae) taken in the South Georgia area in 1990

   /86 year classes. The first small peak corresponds with the strong 1988 year class. File:  17 ... to analogous UK data from the Hill Cove cruise. 286 3. DISCUSSION An analysis of age/length ... gunnari from a range of age classes. CCAMLR/86/FA/12. Hobart, Australia. p. 12. KOCK, K.-H. 1981 ... and biology of Chaenichthyids from South Georgia. Nytt Magaz. Zool., 3: 79-93. Oslo. PANNELLA, G ... rossii from South Georgia. SC-CAMLR-VI/BG/43: 1-43. Hobart, Australia: CCAMLR. . RADTKE, RL. and D.J ...

   Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 285–293 : Autor(es): Kochkin, P.N.

6. Letter from the Co-conveners

   WG-FSA (CCAMLR-XXXVII, paragraph 5.30). These include topics such as further development and ... ccamlr@ccamlr.org, Steve.Parker@niwa.co.nz and clara.peron@mnhn.fr by 30 April 2019. A revised draft ... 0900h Hobart time (Australian Eastern Standard Time) on 3 June 2019. We look forward to seeing you ...

   Document : Site Section: Meetings

7. Fishery Report: Dissostichus eleginoides South Georgia (Subarea 48.3)

   distribution of catches (time series) ......................................... 3 2. Stocks and areas ... ......................................................................... 4 3. Parameters and available data .......................................................... 4 ... 100 tonnes respectively, with an overall catch limit for SGSR of 3 000 tonnes. The total declared ... >1 fish per tonne with a total of 2 968 fish tagged (with 737 recaptures). 3. Most catch has been ...

   Document : Site Section: Publications

8. Sources of variance in studies of krill population genetics

   regions therefore can not be adequately assessed unless multiple samples are taken from each region. File ... 07 jarman-nicol PROOF for pdf.indd CCAMLR Science ... . Keywords: krill, DNA, sample, genetics, population, CCAMLR 109 Sources of variance in studies of krill ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ...

   Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Autor(es): Jarman, S.N. and S. Nicol

9. Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data

   visual predators. File:  09taki-etal.pdf ... 09 taki et al proof.indd CCAMLR Science, Vol. 12 ... shery data, Scotia Sea, trawling depth, vertical distribution, CCAMLR 165 Vertical migration and ... ; level 3 – dark green. The feeding index for each tow was calcu lated as (occurrence of frequency (%) of ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ...

   Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Autor(es): Taki, K., T. Hayashi and M. Naganobu

10. Fishery Report: Champsocephalus gunnari South Georgia (Subarea 48.3)

    ......................................................................... 2 3. Parameter estimation ................................................................... 3 ... 3.1 Estimation methods ................................................................ 3 ... Acoustic surveys ................................................................... 3 Trawl surveys ... ....................................................................... 3 Standing stock ...................................................................... 3 ...

    Document : Site Section: Publications

Páginas