Résultats de la recherche
-
Analysis of krill trawling positions north of the South Shetland Islands (Antarctic Peninsula area), 1980/81–1999/2000
effect. File: 02kawaguchi-segawa.pdf ... ecosystem. CCAMLR Science, 3: 13-30. Ichii, T. 2000. Krill harvesting. In: Everson, I. (Ed.). Krill ... CCAMLR Scie~~ce, Vol. 8 (2001): 25-36 ANALYSIS OF ... , TO MecTa TpaneHm B OCHOBHOM 3 a ~ ~ c e n ~ OT pacnpegeneHMx 6onee KpynHoro, nonoeospenoro KpHJIR ... sene~oro K ~ M I I X ) , Tatime o ~ a 3 b r ~ a n ~ ~ o s p a c ~ a l o ~ e e BnMxHHe Ha MecTa ...
Science Journal Paper : CCAMLR Science, Volume 8 (CCAMLR Science, Volume 8) : 25–36 : Auteur(s): Kawaguchi, S. and K. Segawa
-
Age determination of Champsocephalus gunnari Lönnberg, 1905 (Channichthyidae) taken in the South Georgia area in 1990
/86 year classes. The first small peak corresponds with the strong 1988 year class. File: 17 ... to analogous UK data from the Hill Cove cruise. 286 3. DISCUSSION An analysis of age/length ... gunnari from a range of age classes. CCAMLR/86/FA/12. Hobart, Australia. p. 12. KOCK, K.-H. 1981 ... and biology of Chaenichthyids from South Georgia. Nytt Magaz. Zool., 3: 79-93. Oslo. PANNELLA, G ... rossii from South Georgia. SC-CAMLR-VI/BG/43: 1-43. Hobart, Australia: CCAMLR. . RADTKE, RL. and D.J ...
Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/7 (Selected Scientific Papers, SC-CAMLR-SSP/7) : 285–293 : Auteur(s): Kochkin, P.N.
-
Letter from the Co-conveners
WG-FSA (CCAMLR-XXXVII, paragraph 5.30). These include topics such as further development and ... ccamlr@ccamlr.org, Steve.Parker@niwa.co.nz and clara.peron@mnhn.fr by 30 April 2019. A revised draft ... 0900h Hobart time (Australian Eastern Standard Time) on 3 June 2019. We look forward to seeing you ...
Document : Site Section: Meetings
-
Fishery Report: Dissostichus eleginoides South Georgia (Subarea 48.3)
distribution of catches (time series) ......................................... 3 2. Stocks and areas ... ......................................................................... 4 3. Parameters and available data .......................................................... 4 ... 100 tonnes respectively, with an overall catch limit for SGSR of 3 000 tonnes. The total declared ... >1 fish per tonne with a total of 2 968 fish tagged (with 737 recaptures). 3. Most catch has been ...
Document : Site Section: Publications
-
Sources of variance in studies of krill population genetics
regions therefore can not be adequately assessed unless multiple samples are taken from each region. File ... 07 jarman-nicol PROOF for pdf.indd CCAMLR Science ... . Keywords: krill, DNA, sample, genetics, population, CCAMLR 109 Sources of variance in studies of krill ... reaction (PCR) using ‘universal’ primer HCO (5’ – taaacttcagggtgaccaaaaaatca – 3’) (Folmer et al., 1994 ... ) and the species-specifi c primer EcLCO (5’ – ggtgcgtgagctgggatagtggg – 3’). EcLCO was designed ...
Science Journal Paper : CCAMLR Science, Volume 9 (CCAMLR Science, Volume 9) : 107–116 : Auteur(s): Jarman, S.N. and S. Nicol
-
Characteristics of seasonal variation in diurnal vertical migration and aggregation of Antarctic krill (Euphausia superba) in the Scotia Sea, using Japanese fishery data
visual predators. File: 09taki-etal.pdf ... 09 taki et al proof.indd CCAMLR Science, Vol. 12 ... shery data, Scotia Sea, trawling depth, vertical distribution, CCAMLR 165 Vertical migration and ... ; level 3 – dark green. The feeding index for each tow was calcu lated as (occurrence of frequency (%) of ... level 3) × 5 / 6. Results Vertical distribution of trawling depth The average trawling depth in SS ...
Science Journal Paper : CCAMLR Science, Volume 12 (CCAMLR Science, Volume 12) : 163–172 : Auteur(s): Taki, K., T. Hayashi and M. Naganobu
-
Fishery Report: Champsocephalus gunnari South Georgia (Subarea 48.3)
......................................................................... 2 3. Parameter estimation ................................................................... 3 ... 3.1 Estimation methods ................................................................ 3 ... Acoustic surveys ................................................................... 3 Trawl surveys ... ....................................................................... 3 Standing stock ...................................................................... 3 ...
Document : Site Section: Publications
-
An index of per capita recruitment
Islands from 1979 to 1998 is presented. File: 11hewitt.pdf ... Short Notes CCAMLR Science, Vol. 7 (2000): 179-196 ... ) echantillonne a proximite des iles Shetland du Sud de 1979 a 1998. B cTaTbe npennomeH cnenymq~i? n o ~ a 3 a ... HJIM II0 rOnaM; (ii) HepeCTHTCR 100% ~ - J I ~ T H M x oco6efi; (iii) clMeeTcx p e n p e 3 e ~ ~ a ... , nOrHOpMaJIbHOe H PaBHOMepHOe paCIIpeneneHHR ~ e p o s r ~ ~ o c ~ e t i R1 H 3 ~ H ~ Y ~ H H R M. P a c n p e ...
Science Journal Paper : CCAMLR Science, Volume 7 (CCAMLR Science, Volume 7) : 179–196 : Auteur(s): Hewitt, R
-
The utilization of seabird censuses for krill monitoring
databases, calling for international cooperation on the subject. File: 16-Marschoff-et-al.pdf ... necessary complement to the land-based monitoring programs being developed by CCAMLR members and can ... purpose of krill abundance monitoring. Bearing in mind the concept of the CCAMLR Working Group on ... consequence of the selection of orthogonal functions as components of vector a'. 11; 3. As _! [fi(t)-fj(t ... was highly abundant 2) Sightings where krill was abundant 3) Sightings where krill was scarce or ...
Science Journal Paper : Selected Scientific Papers, SC-CAMLR-SSP/4 (Selected Scientific Papers, SC-CAMLR-SSP/4) : 393-425 : Auteur(s): Marschoff, E.R., J.G. Visbeek and L.R. Fontana
-
Validation of sink rates of longlines measured using two different methods
archival nature of the data collected. File: 12wienecke-robertson.pdf ... wienecke-robertson proof.indd CCAMLR Science, Vol ... recently required by CCAMLR to achieve longline sink rates of 0.3 m.s–1 to a depth of 15 m (Conservation ... Measure 24-02, see CCAMLR, 2002). In principle, there are two methods of measuring sink rates: time ... , evaluation of methods, CCAMLR 181 Validation of longline sink rates of advantages that bottles have over ...
Science Journal Paper : CCAMLR Science, Volume 11 (CCAMLR Science, Volume 11) : 179–187 : Auteur(s): Wienecke, B. and G. Robertson